Expression of MC4R and AgRP mRNAs in Arcuate Nucleus (ARC)

Expression of melanocortin-4 receptor and agouti-related peptide mRNAs in arcuate nucleus during long term malnutrition of female ovariectomized rats

Abstract

Objective: Melanocortin-4 receptor (MC4R) and agouti-related peptide (AgRP) are involved in energy homeostasis in the rat. The aim of the present study was to evaluate the expression of MC4R and AgRP mRNAs in arcuate nucleus (ARC) during long term malnutrition of female ovariectomized rats.

Materials and Methods: Twelve female ovariectomized rats were divided into two equal groups (n=6) of normal and restricted diet groups. Four ovariectomized rats were selected as controls. Using real-time PCR, the relative expressions (compared to controls) of MC4R and AgRP mRNAs in the ARC of rats were compared between both diet groups.

Results: The relative expression of MC4R and AgRP mRNA in the ARC of female ovariectomized rats during long term malnutrition was higher than those with normal diet (P<0.05).

Conclusion: Changes in the relative expression level of MC4R and AgRP mRNAs during long term malnutrition of rat indicated a stimulatory role of MC4R and AgRP in regulating energy balance in ARC of rat hypothalamus.

Keywords: Melanocortin-4 receptor, Agouti-related peptide, Hypothalamus, Malnutrition, Rat

Introduction

Melanocortin-4 receptor (MC4R) is the cognate receptor for ?-melanocyte stimulating hormone (?-MSH), a cleavage product of proopiomelanocortin (POMC) which is expressed in hypothalamic arcuate nuclei (ARC) neurons (1). This receptor belongs to the melanocotrin receptors and one of the members of G protein-coupled receptors that activates adenylate cyclase (2). MC4R neurons have been observed in ARC, periventricular nuclei (PVN) and medial preoptic area (MPO) and preoptic area (POA) of hypothalamus of rats which these nuclei are involved in regulate appetite (3-5). MC4R blockage relieved an anorectic condition in rat (6). Moreover, MC4R agonist suppresses food intake when administered to rats and mice that lack functional leptin receptors (7). Conversely, centrally administration of a selective MC4R antagonist potently increased food intake in rats (7). Activation of MC4R by agonists such as ?-MSH inhibits feeding and causes weight loss (3). In rodents, stimulation of MC4R causes a reduction in food intake, whereas antagonism of MC4R increases food intake (8). MC4R regulates both sides of the energy intake/energy expenditure balance (9).

Agouti related peptide (AgRP), a MC4R antagonist, stimulated feeding and caused obesity (3). AgRP is the neuropeptide with 132 amino acid that are expressed in the ARC of mice (10) and sheep (11). Using immunohistochemistry, AgRP-containing cell bodies were found almost exclusively in the ARC, but their projections were distributed widely in the hypothalamus, most conspicuously in the PVN, ARC, dorsomedial nuclei, and the posterior hypothalamic area (12). In some species, AgRP neurons are involved in energy balance (13). AgRP is an appetite stimulus (14) and increases during the lack of energy (15). Perfusion of monkey and rodents with AgRP increase food intake (16). Intracerebroventricular (ICV) injection of AgRP, increased food intake and inhibited ?-MSH in the rat (16). Mice with deficient in the MC4R expression (17) or high expression of AgRP (18) were fat. Various hormones such as insulin, leptin and glucocorticoids could change AgRP expression based on homeostasis mechanism (14). Neuropeptide Y (NPY) and the endogenous MC4R antagonist, AgRP, coexist in the ARC, and both exert orexigenic effects (19). Ectopic AgRP expression in the hypothalamus causes obesity in the mouse, while AgRP is expressed by NPY neurons in the ARC (3) and NPY is expressed by neurons that project to important appetite-regulating nuclei, including the PVN (3). NPY injected into the PVN is the most potent central appetite stimulant known (3). The NPY neurons in the ARC are stimulated by starvation, probably mediated by decreases in circulating leptin and insulin (which both inhibit these neurons), and contribute to the increased hunger in energy deficit conditions (3).

These results support the hypothesis that the brain MC4R and AgRP is intimately involved in the control of food intake and act homeostatically to correct negative energy balance. Therefore the aim of the present study was to investigate MC4R and AgRP mRNAs expression in the ARC during long term malnutrition of female ovariectomized rats.

Material and methods

Sixteen female adult (3-4 months old) Sprague-Dawley rats (Rattus norvegicus) that weighed 200±20 g (mean ± SD) were randomly selected from the Laboratory Animal Center of Shiraz University of Medical Sciences, Shiraz, Iran. They were housed under controlled temperature (22±2°C), humidity (60±6%) and light (12 h light to 12 h dark ratio; lights on at 7:30 AM) conditions. All experimental procedures were carried out between 12.00-2.00 pm and in compliance with the Animal Care Committee recommendations of the Shiraz University of Medical Sciences. Standard rat feed (before the start of the study) and water were freely available to them. The rats were ovariectomized to remove the effects of reproductive hormones during the estrous cycle. The rats were anesthetized by ketamine (intraperitoneal injection, 100 mg/kg, Woerden, Netherlands) and xylazine (intraperitoneal injection, 7 mg/kg, Alfazyne, Woerden, Netherlands). They were ovariectomized through a ventral midline incision and after a two week recovery period, further procedures were undertaken.

Standard rat diet contained 90% dry matter, 8% ash, 4.1% crude fat, 21.6% crude protein, 70.8% total digestible nutrients (TDN), 0.4% calcium, 0.35% potassium and 0.1% sodium, which were measured based on AOAC, 1995. Two weeks after surgery, 12 rats were randomly divided into two equal groups and the first group were fed with a complete ration (15 g/kg) of standard rat diet (normal diet group, n=6) and the other group with a half ration (7.5 g/kg) of the first group (restricted diet group, n=6) for 14 days and then were anesthetized with ether and were ethically killed. Four rats of control group were ethically killed two weeks after surgery (day 0).

The rats were decapitated, brains immediately dissected out, and the diencephalon was dissected out by an anterior coronal section, anterior to the optic chiasm, and a posterior coronal cut at the posterior border of the mammillary bodies. To separate ARC from other nuclei, a third coronal cut was made through the middle of the optic tract, just rostral to infundibulum (20). The specimens consisted of ARC and DMH were stored in liquid nitrogen and then stored at -80°C. RNA extraction, DNase treatment, cDNA synthesis and relative real-time PCR procedure were performed as described elsewhere (21). Primers were designed with Allele ID 7 software for the reference gene, AgRP (NM_033650.1) and MC4R (NM_013099.2). The rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (M32599) was used as reference gene for data normalization (Table 1).

Relative expressions of AgRP and MC4R based on the threshold cycle (CT) method were calculated for quantitative real-time PCR data. Using Line-gene K software (22), CT for each sample was calculated. Fold expression of the target mRNAs over reference values was calculated by the equation 2^-??CT (23), where ?CT is determined by subtracting the internal control (corresponding GAPDH CT value) from the specific CT of the AgRP or MC4R. ??CT was obtained by subtracting the ?CT of each experimental sample from that of the control ovariectomized rats.

Normality of the data on the relative expression of AgRP and MC4R mRNAs were evaluated by Kolmogorov-Smirnov test using SPSS version 11.5 (SPSS Inc, Chicago, Illinois). Expression of AgRP and MC4R mRNAs were compared between groups using independent sample t-test. Correlation coefficient of their expression was analyzed by Pearson correlation test. We considered P<0.05 as significant.

Results

Expression of AgRP (P=0.048, Fig 1) and MC4R (P=0.027, Fig 2) mRNAs in the ARC of restricted diet group of female ovariectomized rats was more than normal diet group. Food-restricted rats showed a 6.2 fold increase in the expression of AgRP mRNA in the ARC of the hypothalamus. Moreover, the expression of MC4R mRNA increased 6.7 times in long term food-restricted in comparison with normal feeding female rats. A positive correlation was observed between expression of AgRP and MC4R mRNAs in the ARC of female ovariectomized rats of both diet groups (r=0.99, P<0.001, Fig 3).

Discussion

Results of the present study showed that long term malnutrition increased simultaneously expression of AgRP and MC4R mRNAs in the ARC of rats. Consistent with our findings, fasting increased AGRP expression in rats (24). Moreover, hypothalamic AgRP mRNA expression increased in response to fasting in mice (25)., A 24-h fast resulted in a 2.2-fold increased AGRP mRNA expression in the infundibular nucleus in Japanese quail in comparison with the ad-libitum-fed state (26). A 4-fold increase in the number of AGRP-ir cells in the hypothalamus tuberal region was reported in food-deprived doves and the amount of food consumed by food-deprived birds that were allowed to re-feed attenuated after 5 ng of the MC3R and MC4R agonist MTII (27). Moreover, the AgRP expression level in unfed fish was increased at 3 and 4 h post-fasting than in fed fish but did not affect AgRP mRNA expression after 14 days fasting (28). In common carp, after fasting, expression of MC4R and AgRP gene in brain were decreased and after refeeding comparing with normal fed controls increased sharply (29). Upregulated AMPK activity increases the AgRP expression in response to fasting and decreases POMC peptides in intrauterine fetal growth restricted newborn rats (30). Endogenous AgRP may be involved in luteinizing hormone and prolactin surges during starvation, showing further evidence that the melanocortin system is important for the surges of these hormonal in female rats (31). Leptin administration decreased expression of AgRP mRNA and increased POMC mRNA levels toward baseline (25). Adrenalectomy decreased AGRP, neuropeptide gene expression in the medial basal of the hypothalamus despite the fall in plasma leptin and insulin concentrations which in other situations would increase these neuropeptides. Furthermore, glucocorticoids are not required for fasting-induced upregulation of AGRP and NPY expression (24). Adrenalectomy decreased AgRP and POMC expression in the ARC in fasted and refed animals, respectively (32). During starvation, activated autophagy in neurons of hypothalamus mobilized neuron-intrinsic lipids to generate free fatty acids that increased AgRP levels (33). Mice lacking the expression of MC4R developed hyperphagia resulting in early-onset obesity (34). Changes in the relative expression level of MC4R and AgRP mRNAs during long term malnutrition of rat indicated a stimulatory role of MC4R and AgRP in regulating energy balance in ARC of rat hypothalamus.

Acknowledgments
This research was financially supported by the office of Student Scientific Affairs Management, Shiraz University, Shiraz, Iran.

Conflict of interest

There is no financial interest.

References

1.Martin WJ, McGowan E, Cashen DE, Gantert LT, Drisko JE, Hom GJ, et al. Activation of melanocortin MC4 receptors increases erectile activity in rats ex copula. Eur J Pharmacol. 2002;454(1):71-9.

2.Fredriksson R, Lagerstrom MC, Lundin L-G, Schioth HB. The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol Pharmacol. 2003;63(6):1256-72.

3.Williams G, Harrold JA, Cutler DJ, editors. The hypothalamus and the regulation of energy homeostasis: lifting the lid on a black box. Proceedings-Nutrition Society of London; 2000: Cambridge Univ Press.

4.Krasnow SM, Steiner RA. Physiological mechanisms integrating metabolism and reproduction. In: Neill JD, editor. Knobil and Neills Physiology of reproduction. 3rd ed. St. Louis, MO, USA: Academic Press; 2006. p. 2587.

5.Mountjoy KG, Mortrud MT, Low MJ, Simerly RB, Cone RD. Localization of the melanocortin-4 receptor (MC4-R) in neuroendocrine and autonomic control circuits in the brain. Mol Endocrinol. 1994;8(10):1298-308.

6.Vergoni AV, Bertolini A, Wikberg JES, Schioth HB. Selective melanocortin MC4 receptor blockage reduces immobilization stress-induced anorexia in rats. Eur J Pharmacol. 1999;369(1):11-5.

7.Benoit SC, Schwartz MW, Lachey JL, Hagan MM, Rushing PA, Blake KA, et al. A novel selective melanocortin-4 receptor agonist reduces food intake in rats and mice without producing aversive consequences. J Neurosci. 2000;20(9):3442-8.

8.Koegler FH, Grove KL, Schiffmacher A, Smith MS, Cameron JL. Central melanocortin receptors mediate changes in food intake in the rhesus macaque. Endocrinology. 2001;142(6):2586-92.

9.Balthasar N. Genetic dissection of neuronal pathways controlling energy homeostasis. Obesity. 2006;14(S8):222S-7S.

10.Shutter JR, Graham M, Kinsey AC, Scully S, Luthy R, Stark KL. Hypothalamic expression of ART, a novel gene related to agouti, is up-regulated in obese and diabetic mutant mice. Genes Dev. 1997;11:593-602.

11.Jafarzadeh Shirazi MR, Tamadon A, Namavar MR. Coexpression of gonadotropin inhibitory hormone with Agouti-related peptide in the neurons of arcuate nucleus of ewe hypothalamus. Physiol Pharmacol. 2011;15(2):201-9.

12.Legradi G, Lechan RM. Agouti-related protein containing nerve terminals innervate thyrotropin-releasing hormone neurons in the hypothalamic paraventricular nucleus. Endocrinology. 1999;140(8):3643-52.

13.Luquet S, Perez FA, Hnasko TS, Palmiter RD. NPY/AgRP Neurons Are Essential for Feeding in Adult Mice but Can Be Ablated in Neonates. Science. 2005;310(5748):683-5.

14.Stutz AM, Morrison CD, Argyropoulos G. The Agouti-related protein and its role in energy homeostasis. Peptides. 2005;26(10):1771-81.

15.Hahn TM, Breininger JF, Baskin DG, Schwartz MW. Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat Neurosci. 1998;1:271-2.

16.Rossi M, Kim MS, Morgan DGA, Small CJ, Edwards CMB, Sunter D, et al. A C-terminal fragment of Agouti-related protein increases feeding and antagonizes the effect of alpha-melanocyte stimulating hormone in vivo. Endocrinology. 1998;139(10):4428-31.

17.Huszar D, Lynch CA, Fairchild-Huntress V, Dunmore JH, Fang Q, Berkemeier LR, et al. Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell. 1997;88(1):131-41.

18.Ollmann MM, Wilson BD, Yang Y-K, Kerns JA, Chen Y, Gantz I, et al. Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science. 1997;278(5335):135-8.

19.Broberger C, Johansen J, Johansson C, Schalling M, Hokfelt T. The neuropeptide Y/agouti gene-related protein (AGRP) brain circuitry in normal, anorectic, and monosodium glutamate-treated mice. Proc Natl Acad Sci U S A. 1998;95(25):15043-8.

20.Salehi MS, Namavar MR, Jafarzadeh Shirazi MR, Rahmanifar F, Tamadon A. A simple technique for separation of the anteroventral periventricular and arcuate nuclei in the rat hypothalamus. Anatomy. 2013:In press.

21.Salehi MS, Jafarzadeh Shirazi MR, Zamiri MJ, Pazhoohi F, Namavar MR, Niazi A, et al. Hypo-thalamic expression of KiSS1 and RFamide-related Peptide-3 mRNAs during the estrous cycle of rats. Int J Fertil Steril. 2013;6(4):304-9.

22.Larionov A, Krause A, Miller W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 2005;6(1):62.

23.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402-8.

24.Savontaus E, Conwell IM, Wardlaw SL. Effects of adrenalectomy on AGRP, POMC, NPY and CART gene expression in the basal hypothalamus of fed and fasted rats. Brain Res. 2002;958(1):130-8.

25.Ziotopoulou M, Erani DM, Hileman SM, Bjorbaek C, Mantzoros CS. Unlike leptin, ciliary neurotrophic factor does not reverse the starvation-induced changes of serum corticosterone and hypothalamic neuropeptide levels but induces expression of hypothalamic inhibitors of leptin signaling. Diabetes. 2000;49(11):1890-6.

26.Phillips-Singh D, Li Q, Takeuchi S, Ohkubo T, Sharp PJ, Boswell T. Fasting differentially regulates expression of agouti-related peptide, pro-opiomelanocortin, prepro-orexin, and vasoactive intestinal polypeptide mRNAs in the hypothalamus of Japanese quail. Cell Tissue Res. 2003;313(2):217-25.

27.Strader AD, Schioth HB, Buntin JD. The role of the melanocortin system and the melanocortin-4 receptor in ring dove (Streptopelia risoria) feeding behavior. Brain Res. 2003;960(1):112-21.

28.Wei R, Yuan D, Wang T, Zhou C, Lin F, Chen H, et al. Characterization, tissue distribution and regulation of agouti-related protein (AgRP) in a cyprinid fish (Schizothorax prenanti). Gene. 2013;527(1):193-200.

29.Wan Y, Zhang Y, Ji P, Li Y, Xu P, Sun X. Molecular characterization of CART, AgRP, and MC4R genes and their expression with fasting and re-feeding in common carp (Cyprinus carpio). Mol Biol Rep. 2012;39(3):2215-23.

30.Fukami T, Sun X, Li T, Desai M, Ross MG. Mechanism of programmed obesity in intrauterine fetal growth restricted offspring: paradoxically enhanced appetite stimulation in fed and fasting states. Reprod Sci. 2012;19(4):423-30.

31.Schioth HB, Kakizaki Y, Kohsaka A, Suda T, Watanobe H. Agouti-related peptide prevents steroid-induced luteinizing hormone and prolactin surges in female rats. Neuroreport. 2001;12(4):687-90.

32.Uchoa ET, Silva LE, de Castro M, Antunes-Rodrigues J, Elias LLK. Glucocorticoids are required for meal-induced changes in the expression of hypothalamic neuropeptides. Neuropeptides. 2012;46(3):119-24.

33.Singh R. Autophagy in the control of food intake. Adipocyte. 2012;1(2):75-9.

34.Cui H, Lutter M. The expression of MC4Rs in D1R neurons regulates food intake and locomotor sensitization to cocaine. Genes Brain Behav. 2013;12(6):658-65.

Table 1: Sequences of real-time PCR primers used to evaluate relative expression of AgRP and MC4R genes in the rat

Amplicon length (bp)

Primer sequence

Primer

181

5` TGGGTGTCATAAGCCTGTTGG 3`

5` GCGTCCGTGTCCGTACTG 3`

MC4R-F

MC4R-R

189

5` TGAAGAAGACAGCAGCAGACC 3`

5` TGAAGAAGCGGCAGTAGCAC 3`

AgRP-F

AgRP-R

112

5` AAGAAGGTGGTGAAGCAGGCATC 3`

5` CGAAGGTGGAAGAGTGGGAGTTG 3`

GAPDH-F

GAPDH-R

Fig 1. Mean (± standard error) of the relative expression of agouti-related peptide (AgRP) mRNAs in the arcuate nucleus (n=6) during long term malnutrition in female ovariectomized rats. Different letters indicate significant difference (P<0.05).

Fig 2. Mean (± standard error) of the relative expression of melanocortin-4 receptor (MC4R) mRNAs in the arcuate nucleus (n=6) during long term malnutrition in female ovariectomized rats. Different letters indicate significant difference (P<0.05).

Fig 3. Correlation of the relative expression of agouti-related peptide (AgRP) and melanocortin-4 receptor (MC4R) mRNAs in the arcuate nucleus (n=6) in female ovariectomized rats.

1